Mature sequence sko-miR-4818f

Accession numberMIMAT0020016
IDsko-miR-4818f
Stem-Loop sko-mir-4818f
Sequence
cauugcacaugauaguggggcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).