Mature sequence dme-miR-4979-5p

Accession numberMIMAT0020211
IDdme-miR-4979-5p
Stem-Loop dme-mir-4979
Sequence
auauauacuuguucuauguauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).