Mature sequence emu-let-7-5p

Accession numberMIMAT0020253
IDemu-let-7-5p
Stem-Loop emu-let-7
Sequence
ugagguaguguuucgaaugucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25659494 "High-throughput characterization of Echinococcus spp. metacestode miRNomes" Cucher M, Macchiaroli N, Kamenetzky L, Maldonado L, Brehm K, Rosenzvit MC Int J Parasitol. 45:253-267(2015).