Mature sequence cel-miR-66-3p

Accession numberMIMAT0020315
IDcel-miR-66-3p
Previous IDscel-miR-66*
Stem-Loop cel-mir-66
Sequence
aaauuccuaacggugucaaac
Get sequence
Deep sequencing592 reads, 15 experiments
Database links
QuickGO function

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5