Mature sequence ssc-miR-219a

Accession numberMIMAT0020590
IDssc-miR-219a
Previous IDsssc-miR-219
Stem-Loop ssc-mir-219a
Sequence
agaguugagucuggacgucccg
Get sequence
Deep sequencing3 reads, 3 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).