Mature sequence bdi-miR5171a

Accession numberMIMAT0020715
IDbdi-miR5171a
Previous IDsbdi-miR5171
Stem-Loop bdi-MIR5171a
Sequence
acuuaauaugggacggaagaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).