Mature sequence dme-miR-1006-5p

Accession numberMIMAT0020903
IDdme-miR-1006-5p
Stem-Loop dme-mir-1006
Sequence
ugaguuugaaauugaaaugcguaaa
Get sequence
Deep sequencing261 reads, 41 experiments
Database links
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).