Mature sequence pti-miR5475

Accession numberMIMAT0022108
IDpti-miR5475
Stem-Loop pti-MIR5475
Sequence
ucggaggauuaacgucguuuu
Get sequence
Deep sequencing reads, experiments

References

1