Mature sequence cel-miR-5553-3p

Accession numberMIMAT0022198
IDcel-miR-5553-3p
Stem-Loop cel-mir-5553
Sequence
ucaauggguagcacguggcaaga
Get sequence
Deep sequencing169 reads, 9 experiments
Database links
QuickGO function

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).