Mature sequence sha-miR-100

Accession numberMIMAT0022800
IDsha-miR-100
Stem-Loop sha-mir-100
Sequence
aacccguagauccgaacuugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).