Mature sequence mmu-miR-702-5p

Accession numberMIMAT0022931
IDmmu-miR-702-5p
Stem-Loop mmu-mir-702
Sequence
gugaguggggugguuggcaug
Get sequence
Deep sequencing375 reads, 59 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).