Mature sequence cgr-miR-92b-5p

Accession numberMIMAT0024011
IDcgr-miR-92b-5p
Stem-Loop cgr-mir-92b
Sequence
agggacgggacgcggugcaguguu
Get sequence
Deep sequencing327 reads, 6 experiments

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).