Mature sequence cca-miR6107

Accession numberMIMAT0024541
IDcca-miR6107
Stem-Loop cca-MIR6107
Sequence
aaaggggacaauaucugguacggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).