Mature sequence bta-miR-2285e

• Accession number: MIMAT0024580
• ID: bta-miR-2285e
• Stem-Loop: bta-mir-2285e-1 bta-mir-2285e-2
• Sequence: aaaccugaacgaacuuuuuggc
• Deep sequencing: 14035 reads, 74 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2285e

References

1. PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).