Mature sequence rno-miR-378b

Accession numberMIMAT0024855
IDrno-miR-378b
Stem-Loop rno-mir-378b
Sequence
aguggacuuggagucagaagg
Get sequence
Deep sequencing12752795 reads, 508 experiments
Predicted targets

References

1
PMID:22470567 "Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation" Meng F, Hackenberg M, Li Z, Yan J, Chen T PLoS One. 7:e34394(2012).