Mature sequence gga-miR-101-1-5p

Accession numberMIMAT0026545
IDgga-miR-101-1-5p
Stem-Loop gga-mir-101-1
Sequence
ucgguuaucaugguaccggugcu
Get sequence
Deep sequencing114 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).