Mature sequence hsa-miR-412-5p

Accession numberMIMAT0026557
IDhsa-miR-412-5p
Stem-Loop hsa-mir-412
Sequence
uggucgaccaguuggaaaguaau
Get sequence
Deep sequencing563 reads, 83 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).