Mature sequence mml-miR-154-3p

Accession numberMIMAT0026830
IDmml-miR-154-3p
Stem-Loop mml-mir-154
Sequence
aaucauacacgguugaccuauu
Get sequence
Deep sequencing578 reads, 9 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).