Mature sequence hsa-miR-6852-5p

Accession numberMIMAT0027604
IDhsa-miR-6852-5p
Stem-Loop hsa-mir-6852
Sequence
cccugggguucugaggacaug
Get sequence
Deep sequencing243 reads, 63 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).
2
PMID:23535375 "Interleukin-27 treated human macrophages induce the expression of novel microRNAs which may mediate anti-viral properties" Swaminathan S, Hu X, Zheng X, Kriga Y, Shetty J, Zhao Y, Stephens R, Tran B, Baseler MW, Yang J, Lempicki RA, Huang D, Lane HC, Imamichi T Biochem Biophys Res Commun. 434:228-234(2013).