Mature sequence oan-let-7c-5p

Accession numberMIMAT0028958
IDoan-let-7c-5p
Stem-Loop oan-let-7c-1 oan-let-7c-2
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing21821418 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).