Mature sequence oan-miR-7410-3p

Accession numberMIMAT0028967
IDoan-miR-7410-3p
Stem-Loop oan-mir-7410
Sequence
ugcgauguguagcucugauguac
Get sequence
Deep sequencing160 reads, 1 experiments

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).