Mature sequence ipu-miR-7571

Accession numberMIMAT0029570
IDipu-miR-7571
Stem-Loop ipu-mir-7571
Sequence
caggcuacaugacaccacccuga
Get sequence
Deep sequencing reads, experiments

References

1