Mature sequence hhi-let-7c

Accession numberMIMAT0030345
IDhhi-let-7c
Stem-Loop hhi-let-7c
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing reads, experiments

References

1