Mature sequence mmu-miR-3535

Accession numberMIMAT0031410
IDmmu-miR-3535
Stem-Loop mmu-mir-3535
Sequence
uggauaugaugacugauuaccugaga
Get sequence
Deep sequencing20554 reads, 101 experiments
Database links
Predicted targets
QuickGO function

References

1