Mature sequence mmu-miR-3535

• Accession number: MIMAT0031410
• ID: mmu-miR-3535
• Stem-Loop: mmu-mir-3535
• Sequence: uggauaugaugacugauuaccugaga
• Deep sequencing: 20554 reads, 101 experiments
• Database links:
  • RNAcentral:URS00000FB635_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-3535
  • miRDB:mmu-miR-3535

References

1. PMID:23185045 "Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2" Polikepahad S, Corry DB Nucleic Acids Res. 41:1164-1177(2013).