Mature sequence ppe-miR1511-5p

Accession numberMIMAT0031521
IDppe-miR1511-5p
Stem-Loop ppe-MIR1511
Sequence
cgugguaucagagucauguua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).