Mature sequence pxy-miR-8507-5p

Accession numberMIMAT0033724
IDpxy-miR-8507-5p
Stem-Loop pxy-mir-8507
Sequence
ggggguuuuuggauacgcagaa
Get sequence
Deep sequencing44 reads, 4 experiments

References

1