Mature sequence pxy-miR-8521b

Accession numberMIMAT0033751
IDpxy-miR-8521b
Stem-Loop pxy-mir-8521b-10 pxy-mir-8521b-11 pxy-mir-8521b-8 pxy-mir-8521b-3 pxy-mir-8521b-1 pxy-mir-8521b-4 pxy-mir-8521b-5 pxy-mir-8521b-6 pxy-mir-8521b-7 pxy-mir-8521b-2 pxy-mir-8521b-9
Sequence
cuugucccgaauuuugacucggcc
Get sequence
Deep sequencing1275 reads, 4 experiments

References

1