Mature sequence pxy-miR-274

Accession numberMIMAT0033814
IDpxy-miR-274
Stem-Loop pxy-mir-274
Sequence
uuugugaccgucacuaacgggca
Get sequence
Deep sequencing73 reads, 4 experiments

References

1