Mature sequence atr-miR159

Accession numberMIMAT0033911
IDatr-miR159
Stem-Loop atr-MIR159
Sequence
uuuggauugaagggagcucua
Get sequence
Deep sequencing141527 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).