Mature sequence atr-miR169b

Accession numberMIMAT0033922
IDatr-miR169b
Stem-Loop atr-MIR169b
Sequence
agcaagucgccuuggcuaacc
Get sequence
Deep sequencing38 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).