Mature sequence atr-miR319a

Accession numberMIMAT0033928
IDatr-miR319a
Stem-Loop atr-MIR319a
Sequence
uuggacugaagggagcuccc
Get sequence
Deep sequencing36866 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).