Mature sequence atr-miR394

Accession numberMIMAT0033936
IDatr-miR394
Stem-Loop atr-MIR394
Sequence
uuggcauucuguccaccucc
Get sequence
Deep sequencing1601 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).