Mature sequence atr-miR477

Accession numberMIMAT0033946
IDatr-miR477
Stem-Loop atr-MIR477
Sequence
agaggccuuaggggagagugg
Get sequence
Deep sequencing198 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).