Mature sequence rno-miR-15a-3p

Accession numberMIMAT0035729
IDrno-miR-15a-3p
Stem-Loop rno-mir-15a
Sequence
aggccauauugugcugccuca
Get sequence
Deep sequencing206 reads, 139 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).