Mature sequence chi-miR-33b-3p

Accession numberMIMAT0036154
IDchi-miR-33b-3p
Stem-Loop chi-mir-33b
Sequence
cagugccucggcagugcagcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).