Mature sequence ptr-miR-1283b

Accession numberMIMAT0036458
IDptr-miR-1283b
Stem-Loop ptr-mir-1283b
Sequence
cugcaaagggaagcccuuuc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).