Mature sequence tch-let-7a-5p

Accession numberMIMAT0036483
IDtch-let-7a-5p
Stem-Loop tch-let-7a
Sequence
uaagguaguagauuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1