Mature sequence tch-let-7a-3p

Accession numberMIMAT0036484
IDtch-let-7a-3p
Stem-Loop tch-let-7a
Sequence
cuauacaaucuacugucuuucc
Get sequence
Deep sequencing reads, experiments

References

1