Mature sequence hsa-miR-190b-3p

Accession numberMIMAT0037332
IDhsa-miR-190b-3p
Stem-Loop hsa-mir-190b
Sequence
acuaaaugucaaacauauucu
Get sequence
Deep sequencing17 reads, 10 experiments

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).