Mature sequence dya-miR-992-5p

Accession numberMIMAT0039164
IDdya-miR-992-5p
Stem-Loop dya-mir-992
Sequence
uaguaucagcaagguguaauuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).