Mature sequence sfr-miR-2766-5p

Accession numberMIMAT0041916
IDsfr-miR-2766-5p
Stem-Loop sfr-mir-2766
Sequence
ccauccuucgucucgacuggcg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).