Mature sequence bta-miR-2285bu

Accession numberMIMAT0046640
IDbta-miR-2285bu
Stem-Loop bta-mir-2285bu-1 bta-mir-2285bu-2
Sequence
aagaccugaaugaacuuuuugg
Get sequence
Deep sequencing10698 reads, 74 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).