Mature sequence bta-miR-2285cb

Accession numberMIMAT0046651
IDbta-miR-2285cb
Stem-Loop bta-mir-2285cb
Sequence
aacacccggaugaacuuuugg
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).