Mature sequence bta-miR-2285dl-3p

Accession numberMIMAT0046756
IDbta-miR-2285dl-3p
Stem-Loop bta-mir-2285dl-1 bta-mir-2285dl-2
Sequence
auaaccugaaugaacuuuuugg
Get sequence
Deep sequencing9065 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).