Stem-loop sequence hsa-mir-217

AccessionMI0000293 (change log)
Symbol HGNC:MIR217
DescriptionHomo sapiens miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   aguauaauuauuacaua    uu     c c  a  c     c          u -   aag 
5'                  guuu  gaugu g ag ua ugcau aggaacugau g gau   a
                    ||||  ||||| | || || ||||| |||||||||| | |||    
3'                  caaa  cuacg c uc gu acgua uccuugacua c cug   a
   --------------gaa    -u     a u  c  u     a          c a   acu 
Get sequence
Deep sequencing
45557 reads, 533 reads per million, 24 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 55982967-55983076 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-217
hsa-mir-216achr2: 55988950-55989059 [-]
hsa-mir-217chr2: 55982967-55983076 [-]
Database links

Mature sequence hsa-miR-217-5p

Accession MIMAT0000274
Sequence

35 - 

uacugcaucaggaacugauugga

 - 57

Get sequence
Deep sequencing42308 reads, 23 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-217-3p

Accession MIMAT0037308
Sequence

72 - 

caucaguuccuaaugcauugcc

 - 93

Get sequence
Deep sequencing3247 reads, 14 experiments
Evidence not experimental

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).