miRBase entry: mmu-mir-199b

Stem-loop mmu-mir-199b


Accession
MI0000714
Symbol
MGI: Mir199b
Description
Mus musculus mmu-mir-199b precursor miRNA
Gene family
MIPF0000040; mir-199

Literature search
77 open access papers mention mmu-mir-199b
(385 sentences)

Sequence

3043807 reads, 15654 reads per million, 106 experiments
ccagaggauaccuccacuccgucuaCCCAGUGUUUAGACUACCUGUUCaggacucccaaauuguACAGUAGUCUGCACAUUGGUUAggcugggcuggguuagacccucgg
((.((((.....(((((((.(((((.(((((((.((((((((.(((.(((..........))).))))))))))).))))))).))))).))).))))......))))))

Structure
  a    -auacc    -   c     C       U        C   U   gacu 
cc gagg      ucca cuc gucua CCAGUGU UAGACUAC UGU Cag    c
|| ||||      |||| ||| ||||| ||||||| |||||||| ||| |||     
gg cucc      gggu ggg cggAU GGUUACA GUCUGAUG ACA guu    c
  -    cagauu    c   u     U       C        -   u   aaac 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse miR-199b is predicted based on homology with the previously identified human miR-199b (MIR:MI0000282) [1,2]. Landgraf et al. later showed that the 3' product is the predominant one [3].

Genome context
chr2: 32318460-32318569 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-199b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-199b-5p

Accession MIMAT0000672
Description Mus musculus mmu-miR-199b-5p mature miRNA
Sequence 26 - CCCAGUGUUUAGACUACCUGUUC - 48
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-199b-3p

Accession MIMAT0004667
Description Mus musculus mmu-miR-199b-3p mature miRNA
Sequence 65 - ACAGUAGUCUGCACAUUGGUUA - 86
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73