Stem-loop ath-MIR394b

Accession

MI0001006

Description

Arabidopsis thaliana ath-MIR394b precursor miRNA

Gene family

MIPF0000100; MIR394

Literature search

12 open access papers mention ath-MIR394b
(24 sentences)

Sequence

cuuacagagaucuUUGGCAUUCUGUCCACCUCCucucucuauauuuauguguaauaaguguacguaucuacgguguguuucguaagaggAGGUGGGCAUACUGCCAAUAGagaucuguuag
((.(((((..(((((((((...((((((((((((((...(((((((((.....)))))))))......(((((......)))))))))))))))))))...)))))).)))..))))).))

Structure

  u     ga   -      UUC              -------------------cuc         g 
cu acaga  ucu UUGGCA   UGUCCACCUCCucu                      uauauuuau u
|| |||||  ||| ||||||   ||||||||||||||                      ||||||||| g
ga ugucu  aGA AACCGU   ACGGGUGGAggaga                      augugaaua u
  u     ag   U      CAU              augcuuuguguggcaucuaugc         a 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1].

Genome context

chr1: 28568808-28568928 [+]

Mature ath-miR394b-5p

• Accession: MIMAT0000937
• Description: Arabidopsis thaliana ath-miR394b-5p mature miRNA
• Sequence: 14 - UUGGCAUUCUGUCCACCUCC - 33
• Evidence: experimental ; 5'RACE [1], Northern [1], PCR [1], 454 [2-3], MPSS [2]

Mature ath-miR394b-3p

• Accession: MIMAT0031907
• Description: Arabidopsis thaliana ath-miR394b-3p mature miRNA
• Sequence: 90 - AGGUGGGCAUACUGCCAAUAG - 110
• Evidence: not_experimental

References

1. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


2. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


3. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799