Stem-loop osa-MIR395a

Accession

MI0001042

Description

Oryza sativa osa-MIR395a precursor miRNA

Gene family

MIPF0000016; MIR395

Literature search

40 open access papers mention osa-MIR395a
(186 sentences)

Sequence

1 reads, 0 reads per million, 1 experiments

uuguccacuggaguucuccucaauccacuucaguagauagcuauggcuaggccucauugcauugcacuguuacauaacugugaucauggggccaaaagcuagcuauguauaGUGAAGUGCUUGGGGGAACUCcaguugacac
.((((.(((((((((((((.(((..((((((((((.((((((..((((.((((((((.(.((((((..(((....))))))))))))))))))...)))))))))).)))..))))))).)))))))))))))))).)))).

Structure

u    c             u   uc       --   g      au    --a        u c      cu   a 
 uguc acuggaguucucc caa  cacuuca  gua auagcu  ggcu   ggccucau g auugca  guu c
 |||| ||||||||||||| |||  |||||||  ||| ||||||  ||||   |||||||| | ||||||  |||  
 acag ugacCUCAAGGGG GUU  GUGAAGU  uau uaucga  ucga   ccggggua c uagugu  caa a
c    u             -   -C       Ga   g      --    aaa        - -      --   u 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

Chr4: 31805494-31805635 [-]

Clustered miRNAs

6 other miRNAs are < 10 kb from osa-MIR395a

Mature osa-miR395a

• Accession: MIMAT0000973
• Description: Oryza sativa osa-miR395a mature miRNA
• Sequence: 112 - GUGAAGUGCUUGGGGGAACUC - 132
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


2. PubMed ID: 16117853
   Molecular evolution of the rice miR395 gene family
   "Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L"
   "Cell Res (2005) 15:631-638


3. PubMed ID: 19903869
   Rice MicroRNA effector complexes and targets
   "Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y"
   "Plant Cell (2009) 21:3421-3435