Stem-loop sequence osa-MIR397a

AccessionMI0001049 (change log)
DescriptionOryza sativa miR397a stem-loop
Gene family MIPF0000120; MIR397
Literature search

39 open access papers mention osa-MIR397a
(211 sentences)

Stem-loop 
   a          c        c           acaa   -ua       -c    ug 
5'  ucaaaugcau auugagug agcguugauga    cgg   accgguc  augu  a
    |||||||||| |||||||| |||||||||||    |||   |||||||  ||||   
3'  gguuugcgua uaacucac ucgcgacuacu    guc   uggccgg  uacg  u
   c          c        u           acua   uag       uu    cg
Get sequence
Deep sequencing
536 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 28489785-28489898 [+]
intergenic
Database links

Mature sequence osa-miR397a

Accession MIMAT0000980
Sequence

11 -  

ucauugagugcagcguugaug

 - 31

Get sequence
Deep sequencing535 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).