![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR168a |
|||||
Accession | MI0001115 (change log) | ||||
Description | Oryza sativa miR168a stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
![]()
70 open access papers mention osa-MIR168a | ||||
Stem-loop |
c g gc au c cc g c 5' cg cuc g ucgcuuggugcag cggga ccg gcc ccg u || ||| | ||||||||||||| ||||| ||| ||| ||| 3' gc gag c agugaaccacguu gcccu ggc cgg ggc g c g ua cc a -- - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR168 family [1]. It is predicted to target mRNAs coding for the ARGONAUTE protein. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR168a-5p |
|
Accession | MIMAT0001045 |
Previous IDs | osa-miR168a |
Sequence |
11 - ucgcuuggugcagaucgggac - 31 |
Deep sequencing | 432603 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR168a-3p |
|
Accession | MIMAT0015122 |
Sequence |
56 - gaucccgccuugcaccaagugaau - 79 |
Deep sequencing | 499 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:19903869
"Rice MicroRNA effector complexes and targets"
Plant Cell. 21:3421-3435(2009).
|